Data Types and Type Conversion

Overview

Teaching: 10 min
Exercises: 10 min

Questions

• What kinds of data do programs store?

• How can I convert one type to another?

Objectives

• Explain key differences between integers and floating point numbers.

• Explain key differences between numbers and character strings.

• Use built-in functions to convert between integers, floating point numbers, and strings.

Every value has a type.

• Every value in a program has a specific type.
• Integer (int): counting numbers like 3 or -512.
• Floating point number (float): fractional numbers like 3.14159 or -2.5.
  • Integers are used to count, floats are used to measure.
• Character string (usually just called “string”, str): text.
  • Written in either single quotes or double quotes (as long as they match).
  • The quotation marks aren’t printed when the string is displayed.

Use the built-in function type to find the type of a value.

• Use the built-in function type to find out what type a value has.
• Works on variables as well.
  • But remember: the value has the type — the variable is just a label.

type(52)

<class 'int'>

disease = 'schizophrenia'
type(disease)

str

Types control what operations can be done on values.

• A value’s type determines what the program can do to it.

5 - 3

2

'frontotemporal' - 'fronto'

---------------------------------------------------------------------------
TypeError                                 Traceback (most recent call last)
<ipython-input-2-67f5626a1e07> in <module>()
----> 1 print('frontotemporal' - 'fronto')

TypeError: unsupported operand type(s) for -: 'str' and 'str'

Strings can be added and multiplied.

• “Adding” character strings concatenates them.

roi_label = 'fronto' + 'temporal'
roi_label

fronto temporal

• Multiplying a character string by an integer replicates it.
  • Since multiplication is just repeated addition.

dna_repeat_sequence = 'CAG' * 10
dna_repeat_sequence

CAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

Strings have a length (but numbers don’t).

• The built-in function len counts the number of characters in a string.

len(dna_repeat_sequence)

30

• But numbers don’t have a length (not even zero).

len(52)

---------------------------------------------------------------------------
TypeError                                 Traceback (most recent call last)
<ipython-input-3-f769e8e8097d> in <module>()
----> 1 print(len(52))

TypeError: object of type 'int' has no len()

Must convert numbers to strings or vice versa when operating on them.

• Cannot add numbers and strings.

1 + '2'

---------------------------------------------------------------------------
TypeError                                 Traceback (most recent call last)
<ipython-input-4-fe4f54a023c6> in <module>()
----> 1 1 + '2')

TypeError: unsupported operand type(s) for +: 'int' and 'str'

• Not allowed because it’s ambiguous: should 1 + '2' be 3 or '12'?
• Some types can be converted to other types by using the type name as a function.

1 + int('2')

3

str(1) + '2'

12

Can mix integers and floats freely in operations.

• Integers and floating-point numbers can be mixed in arithmetic.
  • Python automatically converts integers to floats as needed.

1 / 2.0

0.5

Division Types

The // operator calculates the whole-number result of division, while the ‘%’ operator calculates the remainder from division:

5 // 3

1

5 % 3

2

# three squared is:
3.0 ** 2

# three squared is :
9.0

Variables only change value when something is assigned to them.

• If we make one cell in a spreadsheet depend on another, and update the latter, the former updates automatically.
• This does not happen in programming languages.

brain_volume = 1246
brain_volume_corrected = brain_volume * 1.2
brain_volume = 1400
brain_volume

1400

brain_volume_corrected

1495.2

• The computer reads the value of brain_volume when doing the multiplication, creates a new value, and assigns it to brain_volume_corrected.
• After that, brain_volume_corrected does not remember where it came from.

Fractions

What type of value is 3.4? How can you find out?

Solution

It is a floating-point number (often abbreviated “float”).

print(type(3.4))

<class 'float'>

Automatic Type Conversion

What type of value is 3.25 + 4?

Solution

It is a float: integers are automatically converted to floats as necessary.

result = 3.25 + 4
print(result, 'is', type(result))

7.25 is <class 'float'>

Choose a Type

What type of value (integer, floating point number, or character string) would you use to represent each of the following?

1. Number of days since the start of the year.
2. Time elapsed since the start of the year.
3. Brain volume.
4. Number of scan sequences used in a scan session.
5. Disease state.
6. Scan sequence name.

Type Conversions with Numbers

float will convert a string to a floating point number, and int will convert a floating point number to an integer:

float("3.4")

3.4

int(3.4)

3

Given that, what do you expect this program to do? What does it actually do? Why do you think it does that?

int("3.4")

Solution

We would expect to return an integer value of 3.
However, it returns the error:

----------------------------------------------------------
ValueError               Traceback (most recent call last)
<ipython-input-92-ec6729dfccdc> in <module>()
----> 1 int("3.4")

ValueError: invalid literal for int() with base 10: '3.4'

Key Points

• Every value has a type.

• Use the built-in function type to find the type of a value.

• Types control what operations can be done on values.

• Strings can be added and multiplied.

• Strings have a length (but numbers don’t).

• Must convert numbers to strings or vice versa when operating on them.

• Can mix integers and floats freely in operations.

• Variables only change value when something is assigned to them.